darA [2017-10-17 13:47:08]

c-di-AMP-binding PII-like protein

Locus: BSU00290

Isoelectric point: 6.09

Molecular weight: 11.83 kDa

Protein length: 109 aa

Gene length: 327 bp

Function: unknown

Product: c-di-AMP-binding PII-like protein

Synonyms: yaaQ

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Targets of second messengers → Targets of c-di-AMP
• Groups of genes → Proteins of unknown function

Gene

Coordinates: 39,871 → 40,200

The protein

Effectors of protein activity

• binds c-di-AMP PubMed

Structure

• 4RLE (the B. subtilis protein in complex with c-di-AMP) PubMed

Expression and Regulation

Operons

• Genes: xpaC-yaaN-yaaO-tmk-darA-yaaR-holB-yaaT-yabA-trmN6-yazA-yabC
  Description: PubMed

• Genes: darA-yaaR-holB-yaaT-yabA-trmN6-yazA-yabC
  Description: PubMed

  Regulation

  • expressed during growth and the transition phase, expression is erduced in stationary phase PubMed

• Genes: tmk-darA-yaaR-holB-yaaT-yabA-trmN6-yazA-yabC
  Description: PubMed

Biological materials

Mutant

• MGNA-B897 (yaaQ::erm), available at the NBRP B. subtilis, Japan
• GP1712 (darA::cat), available in Jörg Stülke's lab PubMed
• GP1713 (darA-yaaR::cat), available in Jörg Stülke's lab
• GP2406 (darA::ermC), available in Jörg Stülke's lab
• GP2415 (darA::spc), available in Jörg Stülke's lab
• BKE00290 (ΔdarA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTGTGAAGGCCTCCTTT, downstream forward: _UP4_CATCAATTTTAAGGATCTGA
• BKK00290 (ΔdarA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTGTGAAGGCCTCCTTT, downstream forward: _UP4_CATCAATTTTAAGGATCTGA

Expression vector

• pGP2797: expression of native darA by pBQ200 in B. subtilis, available in Jörg Stülke's lab
• pGP2601: IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844, available in Jörg Stülke's lab PubMed
• pGP1690: IPTG inducible expression, purification in E. coli with N-terminal cleavable His-tag, in pGP570, available in Jörg Stülke's lab
• pGP2624: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab
• pGP2603: expression of darA-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• GP2010: expression of darA-Strep in B. subtilis (chromosomal), suitable for SPINE, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading